EST 1158697 is a singleton


Sequence

>1158697 (1 EST) Length=159 TTTGTTTTGCTTTTTTTTCTTGGCCTGGGGTTAAAGTATGGATTAAGCTTAGTTTAAATGGTAGTAAGATCATTGTTGAA AAAAGAGTAAATTTGGATATTTAGATGTGATATAATGAGAGAAGATTAAATAGATGTAGAGAAATTGTATTATATATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1158697: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11586972252874AA514109MA2AS015.AASS. mansoni adult Lambda Zap


Date: 12:45:19 on Sun 19 Nov 117.