EST 1158698 is a singleton


Sequence

>1158698 (1 EST) Length=168 TTGTTGTTGATCGATCAAACTCCGTTACAAGTCGAGGTCCAGGAATCGCATTTTGTTTTGAATGAAATTAGTTGAATTCG TCGTGTCGGAATGCGAAATGTCAAATCTAATACATGGATGTTCGCTATTTAAACTCCGGTCGGTCTATTCCGTGTGAGAG TCGAAGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1158698: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11586982252875AA514110MA2AS016.AASS. mansoni adult Lambda Zap


Date: 17:46:32 on Tue 21 Nov 117.