EST 1158705 is a singleton


Sequence

>1158705 (1 EST) Length=179 TAGATCCAGCCTCATCCGCAGCGTCATCAAAGTCTGCTACTGCCTCACCAAGGGGATCAGCCGGAGTGCTCGACAAAGAA AAGCACCGGCTTCTTCAGCTAGATCGTACCAGTGGCCAACTGCTCAGAAAACCGCTGGTCTAGTTTAGTTCAGAAGATTC TCCGGATCAAGTGGACTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1158705: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11587052252882AA514117MA2AS023.AASS. mansoni adult Lambda Zap


Date: 19:20:45 on Sun 19 Nov 117.