EST 1158711 is a singleton


Sequence

>1158711 (1 EST) Length=184 CCATGAATATAACTGTACTAAATCTTCTATGTCTGATAATTCTTATCCTTTTATTCCTTTTCTTTTCTAAGGGATGTAAA TTATTCAATCCATACAATCAAGCAATAAAACTATTCACTCTTAGTGTCTATATATAGATCTAATTACGTACTACCTTCTT CATATTTTCATCTTATCTAGACTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1158711: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11587112252888AA514123MA2AS029.AASS. mansoni adult Lambda Zap


Date: 4:47:25 on Sat 25 Nov 117.