EST 1158713 is a singleton


Sequence

>1158713 (1 EST) Length=229 CGGCGAGAGAGAAACATTCACTTCAACAGCAAACCACTACAATGCCAATTCCTAACTCTCATCATGGTTGTACTTCGTCG TATCGTTCGAATGTCAGAATCCAGTTGTCGCGGGTGCGGGTATGAAATCGCCAATAACGTATTCTCCTGGATTGGCAATA TTGTTAAGAGTTACGAACAACTGACTTATAAGGTTCTAGCAGAGGACGAGTGTCATCGAGAGAGTACTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1158713: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11587132252890AA514125MA2AS031.AASS. mansoni adult Lambda Zap


Date: 4:1:5 on Sun 19 Nov 117.