EST 1158715 is a singleton


Sequence

>1158715 (1 EST) Length=307 GTCATCTGTAACAAGTTCTATGACTGATTCATCAGAAACTGTACGTCGATCAACTAGACGTGTTAGACCACCGAAACGTT ATGATTCTTCAGCCGTCTAGTAATCCATTTAACACAATACATTGTAATCATACTATTGATCTGTTTTTGAAGTTTGTTTC GACAATTTGTTTTTCTGTGAATCTTCGCAAAAATAAAAAAANNGTTTTTGTGAAGTTTTGTTTAAACCGTTCAACTTTGA AGTTGTTACCTATGTGTTTATGTAGTCCCTATGAATTGAAACATGTAAATGGGGTTAGAGTGTACTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1158715: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11587152252892AA514127MA2MA100.AA3S. mansoni adult Lambda Zap


Date: 4:15:11 on Thu 23 Nov 117.