EST 1158725 is a singleton


Sequence

>1158725 (1 EST) Length=141 GAGTTTTTGTTTCTTTTTTCTATTAAAAGAAAGAAAAGAGTTTTATTAAAAAGACAAGACAAAATCTCTATCAATACTTC ACTTTCTGAACTACTTTGTGACTTATACTTCCTAATAAAAAAATACTACCGAACACCATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1158725: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11587252252902AA514098MA2MA110.AA3S. mansoni adult Lambda Zap


Date: 2:58:47 on Mon 20 Nov 117.