EST 1158728 is a singleton


Sequence

>1158728 (1 EST) Length=230 GATTGACATGCTTTTTTTCCCGAAAAAAAATTTTGTCCAGTGTTTTCCATTCTAAAAATGATCCAAAACTAGTTTTATTT ATTAGTTAACTTTTTCTCTGGTCTTCCTATATATATATTTTTTCTTCAGTTTATGCATTATGTCTTCAGTGTTTCTTCTT TACTACTTTTTTAAAAATGAGATGAGAAGGTAGTTATCTGTTTATTATGAAGTTTATTTATTTATTTATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1158728: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11587282252905AA514101MA2MA113.AA3S. mansoni adult Lambda Zap


Date: 11:46:46 on Fri 24 Nov 117.