EST 1158732 is a singleton


Sequence

>1158732 (1 EST) Length=265 GTTTTGTTTTACCACGACTCCTAATTATCTTTTTCCTACTTATTTATTGATCAGCGCTTTTTTGGTGTAAATTATCTGTA TTACCTTTTTTTTTTAAAAAAAAAAAACAAAAAAAACTGTTTTTATATGTTTATAAATGAATGAAAAAAAAACAGAATGA TCAAACCACTTATTGATTATTATGTTTATGCATTCCTTNNNAAACTGGAAAGAATCACTCTACACTTTACTTGACACATT AAACAAATCAGTTTACTAATATATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1158732: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11587322252909AA514105MA2MA117.AA3S. mansoni adult Lambda Zap


Date: 8:45:5 on Fri 24 Nov 117.