EST 1158740 is a singleton


Sequence

>1158740 (1 EST) Length=232 CTTAAACTATCAAAAGAGTTAGGCTTTTTGACTGGTTACGAAACAAAAGTTTTACAACAGNCCCATGTAGATGCAGTCAG TATATTGGGTGAAGCATTTGCTTCAGAAGAAAATTTCAATTTTAGTCAACAATCAACAACTAAACGATCAGTCATTTAAT TCCTGTTATGCTTGAGCATAGATTAAGTCCACCACCGGAAGAAAGTTATTCATTGCATAGAAAAATGTCTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1158740: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11587402252917AA514061MA2MA125.AA3S. mansoni adult Lambda Zap


Date: 23:35:58 on Sat 18 Nov 117.