EST 1158743 is a singleton


Sequence

>1158743 (1 EST) Length=239 GTTCTTTCGATATATATACCCTGGCTATGTTTTTCTACCTTAAAAAAATATTTTTTTTACTATCATTTTTCACGTTCTGA ATTAATATTTGTCTCTTTATACTAAGCTGTGGATGTGTTTTTTCCTTTCTATCTTTGTATCAAATTCACTTCTAATTGGA ATACAGTTATTATTATCATTAGTATAATAGTTTCATGAAATGCGATCAGTGACAGTAAACCCCAGGAAAAGAGTCAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1158743: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11587432252920AA514064MA2MA128.AA3S. mansoni adult Lambda Zap


Date: 23:23:27 on Sun 19 Nov 117.