EST 1158744 is a singleton


Sequence

>1158744 (1 EST) Length=237 AAAAGATCAGTTGATCGTGCAATGACATTGACTGCATTAATATATTGTGGTCACATTTTTAGGAATGTTAATTTTAGCTT GGTATATTTCTAGGCGTAGACGTAAAGACTATGCTAGATGGAGAAAAATCGACCGTAAGTTAGCAATGAAGTCAACGTAT CAATAGAGACATCTGACAAGCAAACACAAATCACATTTCGATCATCTTCGATGAGAAAGAAACTTCTTCACTACATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1158744: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11587442252921AA514065MA2MA129.AA3S. mansoni adult Lambda Zap


Date: 21:21:56 on Fri 24 Nov 117.