EST 1158745 is a singleton


Sequence

>1158745 (1 EST) Length=190 TGGAAATATATGGTCAAAAAATTATTTCTCCTGAAACACACTTGGATTTATTGTACCTAATGACTTAGATAAATGTGAAC TAAAACCTTACGTTTCATGGCGATCAAAGCTGGTTGAGGAANGACCACTAACAGCTGAAGTTTTATTTAATAACAGATAT TCACAAAAAATAACTGAAATNTTTAAAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1158745: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11587452252922AA514066MA2MA130.AA3S. mansoni adult Lambda Zap


Date: 15:31:41 on Fri 24 Nov 117.