EST 1158751 is a singleton


Sequence

>1158751 (1 EST) Length=133 GATGAGTAACACTAAGCACTTTGGGTGATACAAAGTCAGAAAGGCTACTATCTGAAACTTATAAATAGATTAGTGTATGA TAAATTAGTATATAGGTAAAGATATAAAGAAGTAGAACGCACAAAGATGGTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1158751: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11587512252928AA514072MA2MM029.AA3S. mansoni adult Lambda Zap


Date: 16:40:39 on Sat 18 Nov 117.