EST 1158753 is a singleton


Sequence

>1158753 (1 EST) Length=167 GTTTAGCATTGTATGTATTCGATGGTAGAGAAATATTTTGTGGCTGTTTGTTATTTGATTGGGATATAAATAAAAATATA GCAGTTATAGCAGTTATACATAAAATAATTATATCATAACTAAAAATATATATAGTATATGTTGTGAGAGATATCATATG ATGATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1158753: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11587532252930AA514074MA2MM031.AA3S. mansoni adult Lambda Zap


Date: 0:41:11 on Fri 24 Nov 117.