EST 1158755 is a singleton


Sequence

>1158755 (1 EST) Length=318 GATNCGCTAGACTAGGAATTCTTCGCTTAATATCNCGGTTGGGCTCACAGGCTCTGACACAAGCTTGCTGAGTCTGGAAG ATGTTTCTCTGGGGTGTGTAGCTGTCCACACATCTACTCAAGACGCTGACCTTCTTGCAGGAGTTTGACCTGTGGTCATA TGTCAGGCGTACACGTTGTAGGTGGCGTCGTAACTGTTGGCGATGCAGGAAGCGTCGATGTGACCACAGTTGTTGTGTGC TGGGAAGTTGTAGCCATTCGAGTTACATTCATCNACATGGTAGCTGTTGTNATTTTCCTGGAGAGAGTTGTTACATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1158755: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11587552252932AA514076MS2MM033.AS7S. mansoni sporocyst Lambda gt11


Date: 9:2:12 on Sat 18 Nov 117.