EST 1158758 is a singleton


Sequence

>1158758 (1 EST) Length=195 GGGGGATTCCTTCTGAGAGCGGGGGTCGCTATTAGGATCCCCCAAGCCGAATTCCAGCACACTGGTGGCCGTTATAGTGG ATCGAGCTCCGGTACCAAGCTTGGCGTAATCATCGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCGTACAATTCACAC AACATAAGAGTGGAAGATAAGTGTAAGAGGTGTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1158758: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11587582252935AA514079MC2AS034.ACSS. mansoni cercarial Lambda Zap


Date: 20:48:1 on Thu 23 Nov 117.