EST 1158759 is a singleton


Sequence

>1158759 (1 EST) Length=274 GGTCTATTTCTAATATCTTCCTTTACATTATCTTCAATGGGACTGATAGTATTATTTTTAACTCTATGTCTAAAAATGTG ATTTCTTCTAAGCCTATCTCTACCTTTTCTGTCCTTGAACTGTAGACCATTTTGTTTAATTAATTAACTCAAAAATCTCC TAGACCTTAAGCTCTCATCTATAAAAGCAATACTAGACGATAATTTCAGACTAAGCACAAACTATAAGAGCTGAGACTAT AGCCAAGCCAAGTCATGATCAAGGAAGGTAGAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1158759: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11587592252936AA514080MC2AS035.ACSS. mansoni cercarial Lambda Zap


Date: 21:0:3 on Wed 22 Nov 117.