EST 1158760 is a singleton


Sequence

>1158760 (1 EST) Length=163 GGAAGCTTTTAAAGTTTCGATGTTAATACACATCAAGATCAAAAAGCTATTGTNGACTGTTGGCCGTAAGATCGTCAGAG CAATTGCAGGTAGCTTTTTCCTCGCAAAGCCAGAAACGTTGTNGCAAGAATTCAGCAGTAGACAAGACCAAGCAAAAATG AAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1158760: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11587602252937AA514081MC2NE013.ACSS. mansoni cercarial Lambda Zap


Date: 2:49:3 on Mon 20 Nov 117.