EST 1158761 is a singleton


Sequence

>1158761 (1 EST) Length=180 ACGAGAAACAACTAGTCATATTTCTCCTAATGTTTCAGAAATATGTATGAAATATCTGTAATTATTCTGCATAATTTTAT CGTATCCATGCATAAAAATTATTATTATGATAACTTACTAATTAATTAATTAACCGATTGATAAGTAAAATCAATCAATT TACGCGCTCAATCAATCAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1158761: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11587612252938AA514082MC2NE014.ACSS. mansoni cercarial Lambda Zap


Date: 0:13:19 on Thu 23 Nov 117.