EST 1158762 is a singleton


Sequence

>1158762 (1 EST) Length=128 CGTATCNTTCCCCATAATTTNAATTANTGATATGAGTGAATTTNTTTNGTNATTGTTTTTATTTGGTGGAAATACTAAGA AGACCAATCCAATGGAAATAAAATAAAAATTGAAAATTTGGGGAAACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1158762: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11587622252939AA514083MC2NE015.ACSS. mansoni cercarial Lambda Zap


Date: 22:14:28 on Fri 17 Nov 117.