EST 1158763 is a singleton


Sequence

>1158763 (1 EST) Length=151 GCGCGATTTAGGGAGGAGGAAAATTTATCGATTTGATAATAAGGGTTGGGTGTAATTGGGTACTTACAGAATTTGGAAAT TTGGNGTTTATGGTTTAAAATTAGGTATCAATTTGGTTTAATTTTGCTTTAAGAAAGCGTTTTAATAACAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1158763: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11587632252940AA514084MC2NE016.ACSS. mansoni cercarial Lambda Zap


Date: 13:41:2 on Thu 23 Nov 117.