EST 1158766 is a singleton


Sequence

>1158766 (1 EST) Length=165 GCACGAGGCTTGGTTGGAATGGGAATAACACTTAACGTAGTAATGAATACTAAGATCACTGGCACCTAAATTCATGTATG AAGAAATGCCTTACTTTTAATCTTTGGTCAAAGGCTCNGCTCATGGTTTCGTAGTAAGGTCAGGTGACACGAGCTGCATA GATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1158766: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11587662252943AA514087MC2NE019.ACSS. mansoni cercarial Lambda Zap


Date: 12:3:46 on Wed 22 Nov 117.