EST 1158768 is a singleton


Sequence

>1158768 (1 EST) Length=160 CAGAATTCCAGTACAAAGAAGACCGTCCTCCGTTTGAAAAACGCCTAGAAGAAGGGCAAAATATACGTAAAAATTTCCCT TCCTTCTTTCCAGTTATTGTTGAAATTTCACCTTGGGCACGTGTGGGCAATCTAGAGAAAAACGAATATCTAGTTTCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1158768: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11587682252945AA514089MC2NE021.ACSS. mansoni cercarial Lambda Zap


Date: 9:58:50 on Wed 22 Nov 117.