EST 1158782 is a singleton


Sequence

>1158782 (1 EST) Length=559 ATTAACCTACTATTGTAACGGAAAATGTCAAAAAAAGACGCCGCCGGGTATTTTTGGATGTAACAATTGATGGTAACCTT GCGGGTCGAATTGTGATGGAATTGTACAATGATATANCACCACGGACGTGTAATAATTTCCTGATGCTTTGTACTGGTAT GGCAGGTACCGGTAAGATTAGTGGCAAACCTTTGCACTACNAAGGATCAACATTTCATCGTGTCATCAAAAATTTCATGA TTCAGGGAGGTGATTTTACGAAAGGTGACGGTACAGGTGGGGAATCAATTTATGGTGGTATGTTTGACGATGAGGAATTC GTTATGAAACATGATGAACCGTTTGTTGTGTCCATGGCGAACAAGGGACCTAATACCAATGGTTCACAGTTTTTCATTAC TACAACACCTGCGCCACATCTCAATAATATCCATGTGGTATTTGGTAAGGTTGTTTCTGGGCAGGAAGTTGTAACCAAAA TCGAATATTTAAGAACTAATTCCAAGAATCGTCCACTAGCTGATGTTGTAATACTTAATTGTGGTGAACTTGTTCGACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1158782: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11587822252959AA514142SWMFCA2249SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 12:0:25 on Thu 23 Nov 117.