EST 1158805 is a singleton


Sequence

>1158805 (1 EST) Length=753 GTCAAACGGATTCTTCTTGAATATNATGAAACNGTNNATCGAGATGTGGAATTTCCAGCAGCTTTGTGTACGAATGACAC AAAGCGGTGATGGAAATNTGAAGCAATATCTGAATGATNCAATGCTCAACTTGGATCCATCAGCACGTCCGACAGCTAAA CAAATTTTGGAATCACATCTGATCAAAAAATGGTGCAATAAAAGCCTCGAACAGGATAAAAATTATTTGGTGAAACGTTT CATTTACGAATTAGATTGGCAAAATCGTTCCAAACTTGATGCTGATGGTTACAATTATAATTCATGTGAAGCGAAAGATA TTCCGGCTGATTTTTACTGGGATGAGACATGGCGAAAACTTGAAAAGCAATCATTTGCTTATCGGTTGTACGTTTATGAT CGAGATAATTTACGAGTAGGAAGCGATATTGAACGATGTTTCACTCCTGCTGATAATTCACTGTTCCAAACATTAATGCT TGCTGTTGATGATGATCACCTTGAAATGTTTGACGTGATACCTATTGATCCAAATATTCGAAATCTATGTTTCTTGCTGA TGAGAACTGCCAAACAACCCGATATAATCTTGGTTAATGTTAAGCCGAAGAAGGTTATATTGAATCTGNCACCGTCCTTG CATTGGCGACGTTGCGTTTCGGGAAAATCCTTGTTTATTTTAAGATAATGCTGAAATCATCTAATATATGGTATAAACTG GAAGGCGCTANCCGTTAATGAACACTNCTCCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1158805: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11588052252982AA514165SWMFCA2280SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 10:35:34 on Mon 20 Nov 117.