EST 1158808 is a singleton


Sequence

>1158808 (1 EST) Length=532 TCTAAAAGGGTGCTTTCGGGAGTATACAAGTACAAAAATGTCAGCAAAGGACTTATCAAAAATGACGGTTGTTCAGCTCC GGGAACAACTGCGATCACGTGGTCTCCCAACAGATGGTACAAAAGCTGCATTAATCGACCGTCTCAAAGCAAGTTATGCG GCTGAAGACACGATATTGAATTCGGATGCCACTGCATCAAAAGATAGCTTAGAGGAAACGGTGCTGGAAGGTGCAATAAA CGAAGACGATATTTTGGGACCAGATACTATAGTCNAAAAGAAGGAAGATTTAGCAGCAGCATTATCGTCAGCATCAGCAA TAACACCGTCGGTGCCTATAATTAGGAAATCCCAAAGTATTCAAAAAGTTGAAGCGAACAAGAAGACAGAAGCCATGATC CACTCATTTGATGCTAAGCTAAAACGAGCTCAGCGTTTTGGATTACCGCTCTCTGATGAACCAATGAAACCGAAACGCGC TGAGCGAATCCGCATGCCATTGGGTGTTGATGCCAACTTGGTGAAATCCTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1158808: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11588082252985AA514168SWMFCA2283SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 19:19:12 on Fri 24 Nov 117.