EST 1158816 is a singleton


Sequence

>1158816 (1 EST) Length=449 AACTTGCGCAAGAAAGATTAGCTCGAGCTTTGCAAGAATGTGAACATTCAGGACGTCTGTGGGCAGAACAATTTTCATGG AAGAACGCCACGGTCGACGTACAAAATCAGTTGATGCTCTGAAGAATGTGAACATACGCCGATTTTATTAGCTGTAGCGA ACTGTTTGGACAGAACGGAAGATCAGAAAGCGCGTGAATGGTTCCAGCGAACTGTCAAATTGACCTGATTGGGGATGCTG GGCGTCTTACAATTCACGTGCATGGTTCACAGAGACAGATTGGTGAAGAAATGCTTGCACTGACGCGTCTGTGATGTGCA GATGTCAAGATGTGAATGCTAACACGATAGATCGATACTGCTGAAATGATATCAGATATATGACTATATACTTTACTTTG TTAGATGATTCTAACGTACACATTACCTATATATGATATCCTATTGCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1158816: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11588162252993AA514176SWMFCA2296SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 12:27:29 on Fri 17 Nov 117.