EST 1170339 is a singleton


Sequence

>1170339 (1 EST) Length=450 AGGGTGCCAACAAGCCGCATGTGCTGAAGGAAGACACGACACGCTGGCGTGCACCTACGCCGCCCTGTTCGNTGGAGTGC ATGTCTGATAAACATCTTGTGGTCTCATGTTTGAGTACGGCATTGTTAATGACGCCGCCAGTGGGGATGTCGGCGGCGAG CAGTATGGCGTTTTTGTGGGTGTCTCTCTTCGGCTATTTGAAGAATCCCACGCAACACCACTACTGCTCCAAAACGACTG GGCCACTGCCTCCTGAGAGTAGTAACAGGGATGACAAAATGCCATATCTTTCAATTCCACTTTTGATGTCCTCAACGACC CATCGAGTCACGCGGGCAGTTTTGCCCTGTTTGGAGAGATACGGNCCATTAAGCGCCACATTATTCACAAAGGGCTATCT ACTTCCTCAGAAGATCGGGGCAAACAATACTCCGGGCCAATGGCAAATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1170339: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11703392267768AA525699TENF0010T.cruzi epimastigote normalized cDNA Library


Date: 16:56:53 on Thu 23 Nov 117.