EST 1170340 is a singleton


Sequence

>1170340 (1 EST) Length=333 GGCACGAGGTTATACTATGATTCTATGCTAGCGCATGGAAGAGATTTGTTTCCTGGCTCCCATGTACTTCTCCATGTTTG GTATGCATTGCACCGCCAAGTGCTGGTAGCCGCAGCCAATGCGGCACACACTCTTTTGCGGATGCAACCCGCTTCTTCTT CCTCGTCAGATGCATCGTCAACAAACAGGCGTAATGCAAACGTCCTTCGGCAGCGTCAAATGCAGGTTGCTCGATGGTGC GCACGTGCATTGGATGTCCTTCACGCCGTTTTGGCTTGGTTGAATGTTGGGAAACTCCAGGGACGAAAAAGCATTGGTTT AAAAATTAATTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1170340: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11703402267769AA525700TENF0134T.cruzi epimastigote normalized cDNA Library


Date: 19:18:48 on Wed 22 Nov 117.