EST 1170342 is a singleton


Sequence

>1170342 (1 EST) Length=156 CACGAAGCACGTTTACCGCCCGTGTTTCAACAACCAACCCACGCTGTTTCGCTAACCGGTTTCAATGAGCCTCAGTGATT CTCCATGGCGCAAACACGGACTTGGGCAAAGCATGTGCAATCCCTACCTCCCCTGAATCNCCGTAACCCTTGCTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1170342: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11703422267771AA525702TENF0137T.cruzi epimastigote normalized cDNA Library


Date: 17:8:31 on Wed 22 Nov 117.