EST 1170343 is a singleton


Sequence

>1170343 (1 EST) Length=175 CACGAGGCGTATTATGCAGTGAAGTGCCTAAAGCCCAGGTACCTTAGCGGTTGTCCCGTAACACGACTATTCTCATAATC ATGTTATCGCATAATGGGCCGAAAATAAAGGAAATACCAGGGCGTTNGGAACTGTCCCAATTGGGAATTATGTTCCCACA GGATTTCAGGGAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1170343: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11703432267772AA525703TENF0138T.cruzi epimastigote normalized cDNA Library


Date: 12:46:19 on Fri 17 Nov 117.