EST 1170344 is a singleton


Sequence

>1170344 (1 EST) Length=116 GACGAGGCAAAACGCAAAATAATAATAATAATAATAAATAGAGATACGATGAGACAGATATCTGTTACAAAATCTCAGCA AGAGGATATGTAAAAAANCCTTTAATAAATATATGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1170344: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11703442267773AA525704TENF0139T.cruzi epimastigote normalized cDNA Library


Date: 11:58:10 on Mon 20 Nov 117.