EST 1170345 is a singleton


Sequence

>1170345 (1 EST) Length=337 GACGAGGCGTGTCGCAGCTGAAGTGGTGCCGCTGCTGGAGGCCACAATTGTGCAGCTCAAGGAGGAGTTGGCGAGGAAGA TGAACAGCTGCAGGCGCAAAAGGGGGAATTGGCATTGCTGTCACGTGATTGGAGGTGGCCAAAGCGACGGTACGACGTCT TTCCCTGCAAAATGTTGTGAAGGTGAAGAGGGGAAGAAAAAGGGCACCACCCTGGTCGAACTCNCCTATGATGCCAAGAA NCACNAATCAATGCTGAAAAACGATCCATGTGGAAGGACTTGTTGTTGTTGTTGTTGCATGTTTCTTTGTTCGGCATATG GAACATAAATTTATATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1170345: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11703452267774AA525705TENF0141T.cruzi epimastigote normalized cDNA Library


Date: 4:20:7 on Fri 24 Nov 117.