EST 1170347 is a singleton


Sequence

>1170347 (1 EST) Length=136 GCTGTTGTTTCTGTGTATTCTCTTGTTGGCGGCAGCGATATTTACAGCGGTGTGAGGGGCACGATGCCGCCAAGAAGAAC GGAGGGGCACCTAAAATAAAANGAACCTCCAAAGGATTGTGTGGCTGCGGCGTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1170347: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11703472267776AA525707TENF0143T.cruzi epimastigote normalized cDNA Library


Date: 20:51:37 on Tue 21 Nov 117.