EST 1170348 is a singleton


Sequence

>1170348 (1 EST) Length=330 ACGAGAAGACGCGGAATAATAATTCAACAACGGCCTGACCGATCGATATCAACGGGCACTGGATTTGACTGAAGGGTCGG TTCTGCAGGAGGCTGTTGAACGTTACATCAGCCATGAGTTGAAGCCCTTCTACTCGAGTGGTGAATTGTGTACAATATGG TGTCCACAGCGACGGGCTGATAGAAAACATGGCGCAGGTGTGGAAGAGACTTAGGCTTTCTGCCCCCCTAAGGAAACTCC GCTTGGGAACGCATGCTTTTTCNTACGGANTCGAGATAAACCCTCCATTCAAGGCTCTTGCAATGGGGTGAAAAAGGAGG GATTTCAACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1170348: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11703482267777AA525708TENF0144T.cruzi epimastigote normalized cDNA Library


Date: 14:34:53 on Tue 21 Nov 117.