EST 1170350 is a singleton


Sequence

>1170350 (1 EST) Length=415 TAAAACGCACAGTTATCTTTAAAAACGTTGTGCATGCAAACGANTTACCTAATTTCATTCAGCCCGCTTTTTATTATTTA GAAGAAATCAACTTGTTGACTTCATCAACAGTGTCTTTGTATGACTTTACGGCGTGTCCAATGATTCTTTTGTCAATGTA AATTTCATAATCATTGCCACCAGCATGTGTTTTATCACCAAAAAAATGAATTTGGTCAAAATCATTTTCCACAAAACGCA GACAATAGCTTTTNTCCCATCCAACTGGAAAGACATCAAAGCTAATCTGGCCTCCAATTGAATAATTTAAGCCGTAATCG GGAAAAGAGTTCTGAAGTNCTTTGATGAGTTTTTCACGGGACGTGATGCTCTTTGTCATATACCTCAAATTCATCTCTTT CCGATTGTGTGCAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1170350: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11703502267779AA525710TENF0018T.cruzi epimastigote normalized cDNA Library


Date: 18:59:31 on Thu 23 Nov 117.