EST 1170355 is a singleton


Sequence

>1170355 (1 EST) Length=481 GGCACGAGGGTTGAAATTACGGTAGCAGGCAGCGATGCAGTCCCTGAAAAGGCATCTCGGGATTTAAAGGCAAGTGAGCT GCAAAAACTTGTCCCGGTTCTTCTTCCGCTGCTCGATCCACCCATCGCGAAGGGGGTGAATGTGTCCGCGGCACAACTCA TTGTGGCCAGCGGCCACACTTCCAGAANAAACGATGTGCATTTGCCTGACTGCCCCGTGATGGCGCACGCGCTTCCACTT ACTGCGCTGGCGGAACACAGTGCCTTTCTGANGCATCCTTGTCGGGCGTGTCTCAAACGGCGCGTCCATTTTCTTTCGAG CGAACACTTCTGCATGCATCTTGAAGAAAATGTACACAGGGTGGTGGGGGTTATTCCACCGGAATGNGAAANCATAGCTG CANGGCANTTTGGGTTTGTNTACGCATTTTACGGATGAATTGTTATTTTCCCCACAACCCGGCGGAACCCCGAATGACTT G


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1170355: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11703552267784AA525715TENF0106T.cruzi epimastigote normalized cDNA Library


Date: 21:47:34 on Sat 18 Nov 117.