EST 1170363 is a singleton


Sequence

>1170363 (1 EST) Length=357 GGCACGAGGCCATCGGATGCACGGAGATCTTCCGAAGCAGAGGAAAAGGCGGGCGCANACGCGATCCAATGGGAAGCCGT TGGTGGATTCCGAGGGAGGAAGAAATTGTCTGCAGCCGCGGGAACGAGACGTGCGGCCAAAGTCCTTCGGCACCGCCNCG CACCACCATGGCTGAAGGGCGGAGTTGCCATTTTGCTATCCCGTGGATGGTGAGAATTTTGAATTATCTGCTGCTTCTAC AATGCATCCAACTGGACGCCCCATTCTCCTTCAGTTCGATTATAATNAGTTTACTCNCCTCTTTATGTCTCGCGGTATAA ACAGGAAATNATCCCCCTTGAGAATGCTCCTTCCTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1170363: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11703632267792AA525723TENF0119T.cruzi epimastigote normalized cDNA Library


Date: 23:6:43 on Fri 24 Nov 117.