EST 1170365 is a singleton


Sequence

>1170365 (1 EST) Length=293 GGCACGAGGCTATTTTCAGTTGTGTGAATTTTTTTTTTGCTTTACGATTGATTTGTTGGAGGAGCTTTGGTTTTGGTGGC TGCTTCACGACACTATGCCTTGTGTGTCGGTTGCGGTTTTTCCGCGTGATGCCCAAGCGTTGGATGGGTGCTTACCCTTC TTTTTGAGTCTGCAGCCCGCCTTTTGCTCATGGCGGCGCAATGGGATCTGCGGCTGCGTTTCGTCNCAGTGTCGCACCTC CCGCTTTTCTCCCTTCCTGTTGGTNGGAATGAACGGTTACGCTCGGTGATTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1170365: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11703652267794AA525725TENF0121T.cruzi epimastigote normalized cDNA Library


Date: 2:48:14 on Thu 23 Nov 117.