EST 1170366 is a singleton


Sequence

>1170366 (1 EST) Length=317 CGCACGAGGGTTTCGCACACTTGACGGGGCGCATGCGGCCTGATGCAGCCACGGCGGCGTTNGCCCTCAAGGCATGCATC AAAGGTCATCAGTGGGTGCTTGCCCTGCGCATTTTTCGGCAAAGTGTGCTCACATCCGCCACGCCACCCCCGCGAGTGGT GACTTATGCCGTGAGAACGGCACTGGTCTCTGGGGCGTGGCAGGCTGCTCTGCNTGTGGTGCAACGGTTTCAGGGCACCA CCATTCCTTTGCTGGCAAACACCGTTTTCAGGCTTATTTCATCCTGAATGCTGGAATNACCCGGTGGAATACTTTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1170366: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11703662267795AA525726TENF0122T.cruzi epimastigote normalized cDNA Library


Date: 12:10:25 on Fri 17 Nov 117.