EST 1170367 is a singleton


Sequence

>1170367 (1 EST) Length=283 CGACGAGGCAACTCGTGGGCTTCTGGACCCAAAGTGGATGCGGGGAAGTTTTTTGTGCACCCATGGCGCTCGTTCGCCAC CCGGAAATGTTTTCACAGTTTTTTGGACCGAACGGTCCCAATTCTTTCCGCGATGCTTCAGCAACTTCTTGCCGTGCACG ATGCGGANTACTCCCTCGTCGTGCGGGTGTGTCTTCACAGGTGTGAATCNACAGGTGATCCATCCTGCGCGAATGTNTCC TCTTAATGTGGCAACCATACCCCCAGGCATTTCTCTTAAGACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1170367: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11703672267796AA525727TENF0123T.cruzi epimastigote normalized cDNA Library


Date: 16:17:45 on Sun 19 Nov 117.