EST 1170369 is a singleton


Sequence

>1170369 (1 EST) Length=220 GGCCGAGTTTTTTCTCCCTTAAAAAGAAAAAAGAAAAAGAGAAGTTGTGCGTGAGTCAATTGTACGCATTTTTTTTTTTG CGTCGAGATGCACGTGGGACCACAAAAAAAAAAAAAATGGAAGCCGTGAAGAAAGGANAGAACGAANAGAAAAAGAAGAA GACTTGGAGTGTCTGTGCACATGCATCAAGCCACACTCCATCCTTCTCCTCCCCCCCATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1170369: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11703692267798AA525729TENF0125T.cruzi epimastigote normalized cDNA Library


Date: 16:22:13 on Sat 18 Nov 117.