EST 1170370 is a singleton


Sequence

>1170370 (1 EST) Length=250 GCCGAGTTTAATACAAGAAACAAAACAAAACAAAAGCAAAAAAAAAAATTTATTAAATAAATTTAGCTTCATGACACGGA TGCAGTTTCCCCACCATTCAAAAGAACTGCACAAAGATCACGAGCAAATTGAATACTTCGCTTCCCATACTTTCTCTGTA GCATCTCTAAGCTACTCTCCTCCACTTTATGGACTGAATAGAAACACGCCACTGGGCACTGCACATACACAGACNTTTTG GAAGGCACGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1170370: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11703702267799AA525730TENF0127T.cruzi epimastigote normalized cDNA Library


Date: 0:44:24 on Wed 22 Nov 117.