EST 1170371 is a singleton


Sequence

>1170371 (1 EST) Length=218 TCTTTTTATTCCTTACCGAACCAAATAATAATAATAATAATAATAATAATAATAATAATAATAATAATAATAATAATAAT AAAGATGAGGACCAAAAGGACACGAAAGAATTAAATGGCTCCAGCAGCCGTACTTCAATTATTACGGGTGCTGGAAGGCT TGCCACCCGCTCGTTCATAAAGACAGCTGGCGCTCAAAAGCCGTTGTTTAACTGTCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1170371: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11703712267800AA525731TENF0128T.cruzi epimastigote normalized cDNA Library


Date: 9:43:51 on Thu 23 Nov 117.