EST 1170378 is a singleton


Sequence

>1170378 (1 EST) Length=302 TAGCAAGAGCCCTGCATGGACAGTCAATATAAATCCCATTTTTCAAATCCCCAAAAAAAGCGTTAGTCCGTGAAAAAAAA AAAAAAGGGTTTTCGCCCCTCCTGCATCAGTTTTCCGTCATGCTTNGCAAACAATTCATGGGGCCCTGCCTCACTCCGGG ATGGGCTCCGCATGTNTGACAAGCGAGGGGCATGCCGGCTAGGNTCGCNTCCTCCCTCGGACAAACAGCAGGGGTCAGAG GGGCAACAAATCCCACAAACATCGCCCCAAATTTGAAGCAAGCGCATGGCAGGCAGCCCGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1170378: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11703782267807AA525738TENF0049T.cruzi epimastigote normalized cDNA Library


Date: 17:48:53 on Mon 20 Nov 117.