EST 1170379 is a singleton


Sequence

>1170379 (1 EST) Length=415 CCTTTTTTTCTTCTCCCCTCTTTCACCTTAAAGCTCAATCCTGTTTCTGAACGACAACAGCCGGCGAAGGCAATTCAAGG ATTCGGCGCCATGTTCACCGCCACCCACCCTAACCCTCCTTTTTTTTTTGTTCATGTCTTTTCTACACCCCTCAGACAAA CAAAAATAAAAATAAAATAATAACCAAAAAAAAAAAAAAAAACTTAGGTATATATGGTAACACTCCACACACTTTTCCTT TTGGTTTCCCTCTTCTTCGGTTGATGCGGACACCACCTCGNACTGCCAATCCCTATGACGGTTTCTGGAATTTNTTTTTT GTTGGTGTTGCTATTTGCTTGTTTTAATTAGNATTATTGGCTTCTCTTGCAGNGGACACCTCACGGACGGGCGGGGTTTG TGNGGCTGTGTGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1170379: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11703792267808AA525739TENF0052T.cruzi epimastigote normalized cDNA Library


Date: 12:46:21 on Sat 18 Nov 117.