EST 1170380 is a singleton


Sequence

>1170380 (1 EST) Length=272 GCCGAGCAGATCGCACGAGGTCGATCATCACAAAACAGACGACATAAGTATTACTGGATGTATGTTGACGGTATAGCGGA AGCCAACCCGTGGATGCTGTATGATTGGTGTCCCGAACGTACCCGTCTCGCAAGGTATCACAAGAGATGCAATGTGTAGC ATGCAAGAGTGAACCGTTCTGGGATTCTTCAAACACCGTGGATGCTGAGATATACTTCTCTGCGTACACATCACTATTCA CTGGGNTCCTCCTCACGCGGATCATCAACTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1170380: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11703802267809AA525740TENF0060T.cruzi epimastigote normalized cDNA Library


Date: 18:35:20 on Sat 18 Nov 117.