EST 1170382 is a singleton


Sequence

>1170382 (1 EST) Length=406 GGCACGAGGGGGTGAATGCTTCGGAAGCGCTTCACGCCCTCCTGAACGGCATGTCTGTTGACAATGAGCGTGAAATATTT TGCGTTTGCCAGTTTAACCAACTTGGCATCGGCGCTGAACTATTTGGAGCGCCACTACCCGGATCGTCTGCAGCAATTTA AGCAGTCCGCAGTGGTGCACATCTTCGAAAAGGGATATAACCTTGCGGTANATAATGTGTCCACATCTCAGGTGTTGGCA GAACCCAAACTGCGTTTTGTTCTGTACATGCCATCCTTTTATGATCCGGCGGCAGCCTTTTCGTTTAGCTCGTGGANTGA GTTTGGCAACCTGGCNAAAGATGCAGGTGCGTCCCAAGCANTTGCGTGGCTTTTCAGCGCATGGGGAAGCAAAAAAAGCT CTCGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1170382: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11703822267811AA525742TENF0068T.cruzi epimastigote normalized cDNA Library


Date: 12:29:8 on Fri 17 Nov 117.