EST 1176707 is a singleton


Sequence

>1176707 (1 EST) Length=333 GAGAAAAGGTTGCAACCTTACGCCCAGTTGGCCAAGATGCTGTGCTCGATCCCGCAGCACAACGCCATCAGCAGCTGTCA CTCTTGAAGCTCTTGCAGGAGACAGTCTACCAGAGTCCCTCACTAACTGACATTAACTGTGACTTGCAAAAGGGCGTCTT GTCTGAAGAAGACACCGGCACCGACGAGGGCGAAGTGATTGGAGAGATGCGACGGCGTCTGCTGCTGAATGCGATTTTCA TGCCATATAGAAAATAAAGTGCATATGCATGTTTGTCTACGTGCTTGCATCAAATGGAGGAGGCAGAGCGGGAACCTCTG CGCACGCATCCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1176707: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767072275643AA532067TENF0353T.cruzi epimastigote normalized cDNA Library


Date: 13:31:49 on Wed 22 Nov 117.